Gum Arabic Suppress Diet-induced Obesity by Alteration of messenger RNA degrees of

The cistrons Involved in lipid Metabolism in Mouse Liver

Abdelkareem A. Ahmed1, 2, Hassan Hussein Musa3, Demin Cai1, Jafaar Sulieman4, Ruqian Zhao1*

1Key Laboratory of Animal Physiology and Biochemistry, Nanjing Agricultural University, Nanjing, 210095, China

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

2Department of Physiology and Biochemistry, Faculty of Veterinary Sciences, University of Nyala, Sudan

3Department of Microbiology, Faculty of Medical Laboratory Sciences, University of Khartoum, Sudan

4Department of Biology, Faculty of Education, University of Nyala, Sudan

* Matching writer:

Dr. Ruqian Zhao

Key Laboratory of Animal Physiology and Biochemistry

Nanjing Agricultural University

Nanjing 210095

P. R. China

Electronic mail: zhao.ruqian @ gmail.com

Tel. : 00862584395047

Facsimile: 00862584398669

Abstraction:Fleshiness is a planetary wellness concern associated with high morbidity and mortality. Curative schemes include surgery and man-made drugs, which may do high costs and serious complications. The anti-obese consequence of dietetic fibre is by and large accepted. Gum Arabic (Acacia Senegal) works as a dietetic fiber that helps cut down organic structure fat deposition. However, the anti-obese effects of the gum Arabic ( GA ) have non been good studied. In this survey, we fed mice either a normal diet ( control ) , low fat diet ( low ) , high fat diet ( high ) or a high fat diet supplemented with 10 % w/w gum Arabic ( High+gum ) for 6 hebdomads. Visceral adipose tissue ( VAT ) , liver weight and plasma lipid profile were measured, and lipid metamorphosis cistrons looks were determined.

The consequences showed that disposal of GA was significantly ( P & A ; lt ; 0.05 ) decreased VAT and blood glucose and increased entire cholesterin, HDL-c and LDL-c concentrations. Administration of GA did non change lipogenic cistron look FAS, SCD and ACC. Similarly, GA did non impact the look of MGL, peroxisome proliferators activated receptor-? ( PPAR-? ) and HMG-CoA reductase ( HMGR ) cistron look. However, GA was significantly ( p & A ; lt ; 0.05 ) down-regulated SREB2 and ATGL cistron look, in contrast GA was significantly ( p & A ; lt ; 0.05 ) up-regulated HSL and tumor mortification factor-? ( TNF-? ) compared to the control groups in the liver.

Cardinal words:gum Arabic, fleshiness, lipid metamorphosis cistrons, mice

1. Introduction

The prevalence of fleshiness is increasing in the populations worldwide ( Nguyen and El-Serag, 2010 ) . Fleshiness is frequently portion of the metabolic syndrome ( Wahba and Mak, 2007 ) , a status which includes insulin opposition ( Qatanani and Lazar, 2007 ) , dyslipidaemia ( Klop et al. , 2013 ) , reduced HDL cholesterin ( Rashid and Genest, 2007 ) and high blood pressure ( Hosick et al. , 2014 ) . Metabolic syndrome increases the hazard for development of cardiovascular diseases such as coronary arteria disease, shot and end-stage nephritic disease ( Hotamisligil, 2006 ) . The fleshiness complications are non determined by absolute sum of fat in the organic structure, nevertheless, it besides depend on its distribution ( Jensen, 2008 ) . The entire organic structure fat and distribution of adipose tissue are found to be associated with cardio-metabolic hazard in grownup females ( Manson et al. , 1990 ) . The most of import factor that determine fat deposition in adipose tissue includes the rates of fatty acids uptake ( Turcotte et al. , 2001 ) , de novo fatty acerb synthesis ( Strable and Ntambi, 2010 ) , triacylglycerols synthesis ( Guo and Jensen, 2003 ) , lipid debasement and conveyance of fatty acids ( Hirsch and Han, 1969 ) .

Obesity develops due to an interaction between familial constituents and certain environmental factors such as a high-fat diet. A recent prospective survey showed that lone topics with a household history of fleshiness gained weight when devouring high fat diets ( Heitmann et al. , 1995 ) . Among the genetically determined factors are low resting energy outgo ( Bogardus et al. , 1986 ; Ravussin et al. , 1988 ) and a low ability to oxidise fat ( Zurlo et al. , 1990 ) , which both have been shown in prospective surveies to be risk factors for weight addition and fleshiness.

Several cardinal enzymes are committed in lipid metamorphosis in the mark tissues ( Zhao et al. , 2010 ) . Fatty acerb synthase ( FAS ) ( Smith et al. , 2003 ) , acetyl-CoA carboxylase ( ACC ) ( Liu et al. , 1994 ) , and glucose-6-phosphate dehydrogenase ( G-6-PDH ) ( Young et al. , 1964 ) are see the key lipogenic enzymes and alterations in their activities was found to change the rates of biogenesis of fatty acids. Furthermore, peroxisome proliferator-activated receptor g ( PPAR-g ) have late been identified as being implicated in lipid metamorphosis in adipose tissue by modulating cistron look of enzymes or proteins involved in lipid metamorphosis, or by transporting fatty acids ( Grindflek et al. , 2000 ) . In contrast, hormone-sensitive lipase ( HSL ) ( Kraemer and Shen, 2002 ) and monoacylglycerol lipase ( MGL ) ( Taschler et al. , 2011 ) are lipolytic enzymes which play a important function in lipid hydrolysis.

Gum Arabic is an comestible, dried gluey exudation from Acacia seyal and Acacia Senegal, which is rich in non-viscous soluble fibre. It is normally used in nutrient industry and pharmaceutical field as an emulsifier and preservative ( Ali et al. , 2009 ) . In the North Africa and Middle East, it has been used as an unwritten hygiene stuff by assorted communities for centuries ( Tyler, 1977 ) . Previous surveies reported that a high consumption of dietetic fibre, including Gum Arabic is associated with good effects on fat metamorphosis ( Ali et al. , 2009 ; Slavin, 2003 ) . Dietary fibre promotes repletion and repletion, alter glycaemic index, affects stomachic voidance, gut endocrine secernment and therefore helps to pull off weight ( Chandalia et al. , 2000 ) .

In both human and animate being, the bulk of surveies look intoing the anti-obese belongingss effects of Gum Arabic focused on organic structure mass index ( Babiker et al. , 2012 ) and fat deposition ( Ushida et al. , 2011 ) . However, the consequence of Gum Arabic on serum lipid profile, organic structure mass index and its association with the lipid metabolic related cistrons look in liver remain ill-defined. In the present survey, we used experimental animate beings to prove our hypotheses that serum lipid profile may be changed and those alterations may be associated with changes in lipid metabolic cistrons look in the liver of mice administrated with Gum Arabic.

2.Materials and Methods

2.1 Animals

The experimental processs were approved by the Animal Ethics Committee of Nanjing Agricultural University ( Nanjing, China ) . Eight-week-old male C57BL/6aˆ‰J mice were housed in a room at 23aˆ‰±aˆ‰1aˆ‰°C with a 12/12-h light–dark rhythm. The animate beings had free entree to H2O and criterion mouse Zhou for an acclimatisation period of 1aˆ‰week. After that, animate beings weighing 23-24aˆ‰g were indiscriminately assigned to four groups for the feeding experiment. The control group ( naˆ‰=aˆ‰10 ) was fed standard mouse Zhou, low-fat diet ( low, n =10 ) , high-fat diet ( high, n =10 ) and high-fat diet with gum Arabic groups ( high with gum, naˆ‰=aˆ‰10 ) . The nutrient was purchased from Jiangsu Province Cooperative Medical and Biological Engineering Co. Ltd ( Table 1 ) . Body weight and nutrient consumption were recorded throughout the survey. At the terminal of 5aˆ‰weeks, the whole blood was collected from the orbital pit into EDTA-coated tubings, and plasma was obtained by centrifugation at 3000aˆ‰rpm for 15aˆ‰min at 4aˆ‰°C and stored at -80aˆ‰°C until biochemical analysis. The mice so were killed by rapid beheading. Liver and splanchnic adipose tissue ( VAT ) were dissected and weighed after a short wash in cold phosphate-buffered saline ( pH 7.4 ) . Organs were instantly fresh-frozen in liquid N and stored at -80aˆ‰°C until farther lipid extraction and quantitative polymerase concatenation reaction ( Q.PCR ) analysis.

2.2 Plasma biochemical analysis

Blood glucose, plasma triglycerides, entire cholesterin, and high-density lipoprotein cholesterin ( HDL-C ) and low-density lipoprotein cholesterin ( LDL-C ) were determined enzymatically utilizing commercially available reagent kits ( Nanjing Military Hospital. , Nanjing, China ) .

2.3 Quantitative Real-time PCR

The whole hypothalamus was land in liquid N2, and a part of approximately100 milligram was used for the RNA extraction utilizing the TRIzol entire RNA kit ( Invitrogen, Biotechnology Co, Ltd, Carlsbad, CA, USA ) harmonizing to the manufacturer’s direction s, and so entire RNA was transcribed into complementary DNA utilizing the Takara contrary written text kit ( Takara Biotechnology Dalian, Co. LTD ) . For set uping the consequence of gum Arabic on lipogenic and lipolytic cistrons mRNA expression, real-time PCR was performed in an Mx3000P ( Stratagene, USA ) harmonizing to our old publication ( Li et al. , 2011 ) . Mock RT and No Template Controls ( NTC ) were included to supervise the possible taint of genomic and environmental Deoxyribonucleic acid at the RT and PCR stairss. A pooled sample made by blending equal measures of the RT merchandises ( complementary DNA ) from all the samples was used for optimising the PCR conditions and orienting the standard curves for each mark cistron, and runing curves were performed to see a individual specific PCR merchandise for each cistron. The PCR merchandises were sequenced to formalize the individuality of the amplicons. Primers specific for the PPAR-? , ACC, FASN, HSL, ATGL, MGL, SREBP2, and TNF-? , G6P, HMGR, and SCD ( Table 2 ) were synthesized by Geneary, Shanghai, China. A Mouse GAPDH was used as a mention cistron for standardization intents. The method of 2-??Ct was used to analyse the real-time PCR information ( Livak and Schmittgen, 2001 ) .

2.4 Statistical analysis

Datas are expressed as the mean ± SEM and compared by one manner analysis of discrepancy ( ANOVA ) and Student’s T trial. P & A ; lt ; 0.05 was considered important. All statistical analyses were performed utilizing SPSS 16.0 package ( SPSS, Chicago, IL, USA ) .

3. Consequences

3.1 Body weight, variety meats weight and serum lipoid profile

Supplement with GA significantly decreased VAT compared to command group ( Table 1 ) . In add-on, Supplementation with GA was significantly ( p & A ; lt ; 0.05 ) decreased blood glucose, and significantly ( p & A ; lt ; 0.05 ) increased entire cholesterin ( TC ) , HDL-c and LDL-c ( Table 2 ) .

3.2 Quantitative real-time PCR

Gum Arabic did non change lipogenic cistron look FAS ( Fig. 1A ) , SCD ( Fig. 1B ) and ACC ( Fig. 1C ) . However, it down-regulated SREB2 cistron look in the liver of mice fed with high fat diet ( Fig. 1D ) . GA did non impact the look of MGL, but it is significantly ( p & A ; lt ; 0.05 ) down-regulated ATGL ( Fig. 2A ) , and significantly ( p & A ; lt ; 0.05 ) up-regulated HSL ( Fig. 2C ) . On the other manus, supplementation with gum Arabic has no important consequence on the look of peroxisome proliferators activated receptor-? ( PPAR-? ) cistron ( Fig. 3A ) , but it is significantly ( p & A ; lt ; 0.05 ) up-regulated tumour mortification factor-? ( TNF-? ) ( Fig. 3B ) compared to the control groups in the liver. Supplement with GA has no important consequence on HMG-CoA reductase ( HMGR ) cistron look ( Fig. 3C ) .

4. Discussion

Fleshiness is a good known hazard factor for coronary bosom disease, shot, diabetes and many other abnormalcies, including malignant neoplastic disease ( Hedley et al. , 2004 ; Lear et al. , 2003 ) . In the present survey supplementation with GA significantly decreased VAT and blood glucose. Changes in organic structure composing were reported to bring on with many other fibres consumption whether the fibre is obtained from of course high-fiber diet or when it is ingested in a signifier of a addendum ( Howarth et al. , 2001 ) . This determination besides supports the old studies that the pulverization ( at doses 2, 3, and 4 mg/kg ) significantly reduced the blood glucose concentration of normal coneies ( Wadood et al. , 1989 ) . Furthermore, a mixture of different types of gum has been shown to diminish postprandial blood glucose in human and in inhibit glucose motion in vitro ( Edwards et al. , 1987 ; Torsdottir et al. , 1989 ) .

In the present survey, we reported that GA supplementation significantly increased LDL-c, HDL-c and entire cholesterin concentrations but non plasma triglycerides ( TG ) concentrations. The effects of GA on blood lipoid profile are variable ( Ali et al. , 2009 ) . It is found to increase cholesterin biogenesis in rat fed with cholesterin incorporating diet, while had no consequence in rat fed with cholesterol-free diet ( Kelley and Tsai, 1978 ) . The consequence of GA has shown both lessening ( Sharma, 1985 ) or increase or had no consequence on plasma lipid profile ( Haskell et al. , 1992 ; Jensen et al. , 1993 ) . Assorted mechanisms have been proposed to explicate the hypercholesterolemic consequence of GA ( Kelley and Tsai, 1978 ; Moundras et al. , 1994 ) . Some surveies have suggested that the viscousness of fermentable dietetic fibres contribute well to the lipid lowering effects in animate beings and worlds ( Gallaher et al. , 1993 ; Moundras et al. , 1994 ) . While other proposes that this belongings does non associate to plasma lipoids ( Evans et al. , 1992 ) . The mechanism most clearly implicated is that GA increased faecal gall acid and impersonal steroid alcohol elimination or a modii¬?cation of lipid digestion and soaking up ( Eastwood, 1992 ) .

In this survey, the lessening of VAT in GA supplemented mice was associated with changes in the liver look of lipogenic and lipolytic enzymes cistrons. Significant alterations in the lipogenic and lipolytic in liver include lessening in SREB2 messenger RNA look, which was associated with up-regulation of lipogenic cistron mRNA look in the liver. The mRNA look of lipolytic cistron ATGL was down-regulated in mice fed diet supplemented with GA. On the other manus, supplementation with GA besides up-regulated the mRNA degree of the tumour mortification factor-? ( TNF-? ) in the liver. Furthermore, HMG-CoA reductase ( HMGR ) mRNA look was significantly ( p & A ; lt ; 0.05 ) lower in the in GA supplemented.

Discuss this subdivision

Decision

We conclude that the supplementation of GA decreased accretion of splanchnic fat through change of lipogenic and lipolytic enzyme cistron look in the liver through change of the HPA axis and the 5-HT system. CORT exposure caused epigenetic alterations of the cistron boosters taking to the re-programming of the HPA map and behaviour. It is possible that these effects could be transmitted across multiple coevalss. Decision is for lily-livered paper

Recognition

The writers are extremely thankful to Professor Ruqian Zhao and Professor Shi Fangxiong at the Nanjing Agricultural University, China for their support to carry on this research.

Figure fable

Figure 1: The consequence of GA supplementation on lipogenic cistrons mRNA expression in the liver of mice fed with high fat diet, FASN ( A ) , SCD ( B ) , ACC ( C ) and SREBP2 ( D ) .The values are the agencies ± SEM, n=10/group.

Figure 2: The consequence of GA supplementation on lipolytic cistrons mRNA expression in the liver of mice fed with high fat diet, ATGL ( A ) , MGL ( B ) and ( HSL ) ( C ) .The values are the agencies ± SEM, n=10/group.

Figure 3: The consequence of GA supplementation on adipogenic and apoptotic cistrons mRNA expression in the liver of mice fed with high fat diet, PPAR-? ( A ) , TNF-? ( B ) and ( HMGR ) ( C ) .The values are the agencies ± SEM, n=10/group.

Table 1: The consequence of GA supplementation on variety meats weight of mice fed with high fat diet ( A ) . The values are the agencies ± SEM, n=10/group.

Table 2: The consequence of GA supplementation on serum lipid profile of mice fed with high fat diet ( A ) . The values are the agencies ± SEM, n=10/group.

Fig. 1

A

Bacillus

C

Calciferol

Fig. 2

A

Bacillus

C

Fig. 3

A

Bacillus

C

Table 1:The consequence of GA supplementation on variety meats weight of mice fed with high fat diet

Group ( n=10 )

Liver weight ( g )

VAT weight ( g )

Control

1.8±0.11a

1.7±0.49b

Low

1.7±0.01a

1.6±0.10b

High

1.9±0.15a

2.2±0.18a

High with gum

1.6±0.10a

1.2±0.14c

Table 2: The consequence of GA supplementation on serum lipid profile of mice fed with high fat diet

Group ( n=5 )

Blood glucose

Triglyceride

Entire cholesterin

HDL-c

LDL-c

Control

5.08±0.60a

1.6±0.20a

1.9±0.18a

1.4±0.15a

0.2±0.03a

Low

4.6±0.41a

1.4±0.10a

2.9±0.23B

2.02±0.14B

0.5±0.04B

High

4.8±0.21a

2.1±0.22B

3.7±0.27degree Celsiuss

2.7±0.16degree Celsiuss

0.4±0.05degree Celsiuss

High with Gum

3.7±0.42B

1.8±0.09a

3.8±0.20cadmium

2.7±0.14cadmium

0.31±0.01B

Table 3: Food foods for different groups of mice

Food

Low fat ( LF )

High fat ( HF )

High fat + Gum Arabic

Casein

19.0

25.8

25.8

L-Cystine

0.3

0.4

0.4

Cornstarch

56.8

Maltodextrin

3.3

16.2

10.2

Sucrose

6.6

8.9

6.4

Cellulose

4.8

6.5

5.5

Soy oil

2.4

3.2

3.2

Lard

1.9

31.17

31.17

Mineral mix1

1.0

1.3

1.3

Dicalcium phosphate

1.2

1.7

1.7

Calcium carbonate

0.5

0.7

0.7

Potassium citrate 1H20

1.6

2.1

2.1

Vitamin mix1

1.0

1.3

1.3

Choline bitartrate

0.2

0.3

0.3

Gum Arabic

10

Entire

100.5

100.0

100.5

Table 4 Real-time PCR Primers

Target cistrons

Gene bank figure

ProductSize

Primer

PPAR-?

NM_001127330.1

110

F: 5?- CACAATGCCATCAGGTTTGG -3?

Roentgen: 5?- GCTCGCAGATCAGCAGACTCT -3?

Air combat command

NM_133360.2

250

F: 5?- AGGCAGCTGAGGAAGTTGGCT -3?

Roentgen: 5?- CGCTGCACAGAGCAGTCACG -3?

FASN

NM_007988.3

129

F: 5?- GATATTGTCGCTCTGAGGCTGTTG -3?

Roentgen: 5?- GGAATGTTACACCTTGCTCCTTGC -3?

Doctor of science

NM_009127.4

75

Roentgen: 5?- GGCCTGTACGGGATCATACTG -3?

Roentgen: 5?- GGTCATGTAGTAGAAAATCCCGAAGA -3?

HSL

NM_001039507.2

123

F: 5?- CGCACGATGACACAGTCG -3?

Roentgen: 5?- CTAGGCCAACTGTTGGGTG -3?

ATGL

NM_001163689.1

236

F: 5?- CTGAACCAACCCAACCCT-3?

Roentgen: 5?- GGTCATCAGGTCCTTTGGT-3?

MGL

NM_001166251.1

168

F: 5?- ACAGACTTGTGCCCGTCAACT -3?

Roentgen: 5?- CGAATGCGCGGTGCCGCGGA -3?

SREBP2

NM_011480.3

86

F: 5?- GTGCGCTCTCGTTTTACTGAAGT-3?

Roentgen: 5?- GTATAGAAGACGGCCTTCACCAA-3?

HMGCR

NM_008255.2

83

F: 5?- TGACCTTTCTAGAGCGAGTGCAT -3?

Roentgen: 5?- CACGAGCTATATTTTCCCTTACTTCA -3??

TNF-?

NM_013693.2

175

F: 5?- CATCTTCTCAAAATTCGAGTGACAA -3?

Roentgen: 5?- TGGGAGTAGACAAGGTACAACCC -3?

GAPDH

NM_008084.2

141

F: 5?- ACATGGTCTACATGTTCCAGTA -3?

Roentgen: 5?- GGAGTCTACTGGTGTCTTCA-3?

1

x

Hi!
I'm Niki!

Would you like to get a custom essay? How about receiving a customized one?

Check it out